Membrane‐Based Yeast Two‐Hybrid System to Detect Protein Interactions实验方法详情页

实验方法> 生物信息学技术> 数据库>Membrane‐Based Yeast Two‐Hybrid System to Detect Protein Interactions

Membrane‐Based Yeast Two‐Hybrid System to Detect Protein Interactions

关键词： membrane based yeast来源：互联网

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

The classical yeast two?hybrid system and its modifications have been successfully used over the past decade to investigate interactions between most classes of proteins expressed in a given cell or tissue. However, some proteins (e.g., integral membrane proteins or nuclear proteins) are relatively difficult to investigate by standard yeast two?hybrid methods either because they are retained at cellular membranes or they activate the system in the absence of a true protein interaction. The membrane?based yeast two?hybrid (MbY2H) system presented in this unit overcomes some of these limitations. It is based on the split?ubiquitin protein complementation assay and detects protein interactions directly at the membrane, thereby allowing the use of full?length integral membrane proteins and membrane?associated proteins as baits to hunt for novel interaction partners. A simple modification also allows the use of proteins that are self?activating in a classical yeast two?hybrid system (e.g., acidic proteins and many transcription factors). Like the yeast two?hybrid system, the MbY2H system can also be used for interaction discovery by screening complex cDNA libraries for novel interaction partners. Curr. Protoc. Protein Sci. 52:19.7.1?19.7.28. © 2008 by John Wiley & Sons, Inc.

Keywords: membrane proteins; membrane?based yeast two?hybrid system; protein interactions

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library Table of Contents

Introduction
Strategic Planning
Basic Protocol 1: Bait Construction, Transformation into Yeast Reporter Strain, and Detection by Immunoblotting
Basic Protocol 2: Functional Assay to Determine Bait Suitability for Screening
Basic Protocol 3: Pilot Screen to Optimize the Stringency of Selection
Basic Protocol 4: Screening of a cDNA Library to Identify Novel Interactors
Basic Protocol 5: Plasmid Recovery from Yeast
Basic Protocol 6: Confirmation of Positive Bait‐Prey Interactors
Support Protocol 1: Production of Single‐Stranded Carrier DNA from Salmon Sperm
Support Protocol 2: Preparation of Membrane Extracts from Yeast
Support Protocol 3: Determination of Bait‐Prey Protein Interaction Specificity
Reagents and Solutions
Commentary
Literature Cited
Figures
Tables

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library Materials

Basic Protocol 1: Bait Construction, Transformation into Yeast Reporter Strain, and Detection by Immunoblotting Materials

cDNA encoding the bait protein
Primers for subcloning bait cDNA into vector:
- Forward primer: 5′‐TACTCTTATggccattacggcc‐NNN NNN NNN NNN NNN NNN NNN‐3′ (where NNN denotes the gene‐specific sequence)
- Reverse primer: 5′‐TACTCTTATggccgaggcggcc‐GC NNN NNN NNN NNN NNN NNN NNN‐3′ (where NNN denotes the gene‐specific sequence)
DNA gel extraction kit (e.g., NucleoSpin Extract II kit, Macherey‐Nagel; Wizard SV Gel and PCR Clean‐up System, Promega)
Appropriate MbY2H bait vector: pBT3‐C, pBT3‐SUC, or pBT3‐STE (Dualsystems Biotech, see and Internet Resources)
Sfi I restriction enzyme
PCR DNA purification kit (e.g. MinElute PCR Purification kit, Qiagen)
Competent E. coli cells (XL1‐Blue, DH10B, TOP10, or similar cloning strains)
LB plates supplemented with kanamycin (see appendix 4A )
Sequencing primers appropriate to the vector:
- pBT3‐C, pBT3‐SUC, and pBT3‐STE
  - Forward primer: 5′‐TGGCATGCATGTGCTCTG‐3′
  - Reverse primer: 5′‐GTAAGGTGGACTCCTTCT‐3′
- pBT3‐N
  - Forward primer: 5′‐CAGAAGGAGTCCACCTTAC‐3′
  - Reverse primer: 5′‐AAGCGTGACATAACTAATTAC‐3′
- pDHB1
  - Forward primer: 5′‐TTTCTGCACAATATTTCAAGC‐3′
  - Reverse primer: 5′‐GTAAGGTGGACTCCTTCT‐3′
1×YPAD liquid medium (see recipe )
NMY51 yeast strain: MATa his3Δ200 trp1‐901 leu2‐3,112 ade2 LYS2::(lexAop) 4 ‐HIS3 ura3::(lexAop) 8 ‐lacZ ade2::(lexAop) 8 ‐ADE2 GAL4 (Dualsystems Biotech, see Internet Resources)
50% (w/v) PEG 4000 (see recipe )
1 M LiOAC (see recipe )
Single‐stranded carrier DNA ( protocol 7 )
Control plasmids: pCCW‐Alg5 (positive control) and pPR3‐N (negative control), Dualsystems Biotech (see Internet Resources)
0.9% (w/v) NaCl
10‐cm plates containing SD solid medium lacking leucine (SD−Leu; see recipe )
10‐cm plates containing SD solid medium lacking tryptophan (SD−Trp; see recipe )
Bait‐specific antibody or mouse monoclonal antibody against LexA (Dualsystems Biotech, see Internet Resources)

Shaking incubator, 30°C
Parafilm

Additional reagents and equipment for performing PCR amplification ( appendix 4J ), restriction enzyme digestion of DNA ( appendix 4I ), agarose gel electrophoresis ( appendix 4F ), and immunoblotting and immunodetection (unit 10.10 ), and for preparing minipreps of plasmid DNA ( appendix 4C )

Basic Protocol 2: Functional Assay to Determine Bait Suitability for Screening Materials

1×YPAD liquid medium (see recipe )
Yeast strain NMY51 (Dualsystems Biotech, see Internet Resources), growing on plates
50% (w/v) PEG 4000 (see recipe )
1 M lithium acetate (LiOAC; see recipe )
Single‐stranded carrier DNA ( protocol 7 )
Bait construct ( protocol 1 )
Control plasmids: pAI‐Alg5, pDL2‐Alg5, and pPR3‐N (Dualsystems Biotech, see Internet Resources)
10‐cm diameter plates containing SD solid medium lacking tryptophan, leucine, histidine, or adenine (SD−Trp−Leu, SD−Trp−Leu−His, and SD−Trp−Leu−His−Ade; see recipe )
0.9% (w/v) NaCl

Shaking incubator, 30°C
42°C water bath
Parafilm

Basic Protocol 3: Pilot Screen to Optimize the Stringency of Selection Materials

Bait‐transformed yeast strain NMY51 ( protocol 2 ), growing on plate <2 weeks old
SD liquid medium lacking leucine (SD−Leu; see recipe )
2×YPAD liquid medium (see recipe )
Single‐stranded carrier DNA ( protocol 7 )
1 M lithium acetate (LiOAC; see recipe )
10× TE buffer, pH 7.5: 100 mM Tris·Cl, pH 7.5, 10 mM EDTA (see appendix 2E ); store up to 1 year at room temperature
50% (w/v) PEG 4000 (see recipe )
Library vector pPR3‐N (Dualsystems Biotech, see Internet Resources)
Dimethyl sulfoxide (DMSO)
0.9% (w/v) NaCl
10‐cm plates containing SD medium lacking tryptophan and leucine (SD−Trp−Leu; see recipe )
15‐cm selective plates (six total) containing SD medium lacking tryptophan, leucine and histidine (SD−Trp−Leu−His) and (six total) containing SD−Trp−Leu−His−Ade (adenine; see recipe ), both supplemented with 0, 1, 2.5, 5, 7.5 and 10 mM 3‐amino‐1,2,4‐triazole (3‐AT; see recipe )

Shaking incubator, 30°C
50‐ml conical tube
1‐liter shaker flask
99°C heating block
42°C water bath
Plastic bags with tape or Parafilm

Basic Protocol 4: Screening of a cDNA Library to Identify Novel Interactors Materials

Bait‐transformed yeast strain NMY51 ( protocol 1 ), growing on plate for no longer than 2 weeks
SD liquid medium lacking leucine (SD−Leu; see recipe )
2× YPAD liquid medium (see recipe )
Single‐stranded carrier DNA ( protocol 7 )
1 M lithium acetate (LiOAc; see recipe )
10× TE buffer: 100 mM Tris·Cl, pH 7.5, 10 mM EDTA (see appendix 2E ); store up to 1 year at room temperature
50% (w/v) PEG 4000 (see recipe )
Appropriate cDNA library (see Internet Resources)
Dimethyl sulfoxide (DMSO)
0.9% (w/v) NaCl
Sixteen 15‐cm diameter selective plates with appropriate selection medium (determined in protocol 3 )
10‐cm plates containing solid SD medium lacking tryptophan and leucine (SD−Trp−Leu; see recipe )

Shaking incubator, 30°C
50‐ml conical tube
1‐liter shaker flask
42°C water bath
Plastic bags with tape or Parafilm

Basic Protocol 5: Plasmid Recovery from Yeast Materials

Yeast colonies positive for bait/prey interaction ( protocol 4 )
Selection plates (same stringency as protocol 4 )
SD liquid medium lacking tryptophan and leucine (SD−Trp−Leu; see recipe )
Plasmid miniprep kit (e.g., Wizard Plasmid Purification System, Promega), including resuspension buffer, nuclease removal buffer, wash buffer, elution buffer, and spin columns
425 to 600‐µm (30 to 40 U.S. sieve) acid‐washed glass beads (Sigma)
E. coli XL‐1 Blue chemically competent cells (Stratagene)
SOC medium (see appendix 2E ), 37°C
Sfi I restriction enzyme
LB plates supplemented with 100 µg/ml ampicillin (see appendix 2E )

Plastic bags or Parafilm
96‐well deep‐well master block (e.g., Greiner Bio‐One GmbH)
Breathable plate seal (e.g., EasySeal film, Hampton Research)
Shaking incubator, 30°C
Centrifuge with rotor adapted for 96‐well plates
42°C water bath

Additional reagents and equipment for performing restriction enzyme digestion of DNA ( appendix 4I ) and agarose gel electrophoresis ( appendix 4F )

Basic Protocol 6: Confirmation of Positive Bait‐Prey Interactors Materials

Bait‐transformed yeast strain NMY51 ( protocol 1 ), growing on plate
SD liquid medium lacking leucine (SD−Leu; see recipe )
Prey plasmids derived from the library screen (see protocol 5 )
50% (w/v) PEG 4000 (see recipe )
1 M lithium acetate (LiOAc; see recipe )
Single‐stranded carrier DNA ( protocol 7 )
0.9% (w/v) NaCl
10‐cm plates containing SD solid medium lacking tryptophan and leucine (SD−Trp−Leu plates; see recipe )
10‐cm selective plates of the same stringency as used in the original screen ( protocol 4 )
Appropriate sequencing primers:
- Forward primer for pPR3‐N, pDSL‐Nx, and pNubG‐X library plasmids: 5′‐GTCGAAAATTCAAGACAAGG‐3′
- Reverse primer for pPR3‐N and pDSL‐Nx library plasmids: 5′‐AAGCGTGACATAACTAATTAC‐3′
- Reverse primer for pNubG‐X library plasmids: 5′‐GTTACTCAAGAACAAGAATTTTCG‐3′
- Forward primer for pPR3‐C, pDL2xN, and pX‐NubG library plasmids: 5′‐TTTCTGCACAATATTTCAAGC‐3′
- Reverse primer for pPR3‐C, pDL2xN and pX‐NubG library plasmids: 5′‐CTTGACGAAAATCTGCATGG‐3′

Shaking incubator, 30°C
96‐well master block (e.g., Greiner Bio‐One GmbH) and plate sealers
42°C water bath
Centrifuge with rotor adapted for 96‐well plates
Parafilm

推荐方法