Quantification of Gene Transcripts with Deep Sequencing Analysis of Gene Expression (DSAGE) Using 1 to 2 µg Total RNA实验方法详情页

实验方法> 生物信息学技术> 数据库>Quantification of Gene Transcripts with Deep Sequencing Analysis of Gene Expression (DSAGE) Using 1 to 2 µg Total RNA

Quantification of Gene Transcripts with Deep Sequencing Analysis of Gene Expression (DSAGE) Using 1 to 2 µg Total RNA

关键词： quantification of来源：互联网

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

Deep sequencing analysis of gene expression (DSAGE) measures global gene transcript levels from only 1 to 2 µg total RNA by massively parallel sequencing of cDNA tags. This unit describes the construction of 21?bp cDNA tag libraries appropriate for massively parallel sequencing and analysis of the resulting sequence data. The adapter oligonucleotides used are optimized for sequencing with current Illumina massively parallel sequencers, and a step?by?step implementation of the analysis protocol is described. The expression profiles obtained are highly reproducible, enabling sensitive detection of differences between experimental conditions as well as assessment of the relative transcript abundance of different genes. Curr. Protoc. Mol. Biol. 93:25B.9.1?25B.9.16. © 2011 by John Wiley & Sons, Inc.

Keywords: digital gene expression; serial analysis of gene expression (SAGE); gene expression profiling; high?throughput sequencing

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library Table of Contents

Introduction
Basic Protocol 1: DSAGE Library Construction
Basic Protocol 2: Generation and Comparison of Gene Expression Profiles
Alternate Protocol 1: Automated Generation of Expression Profiles for Multiple Samples
Support Protocol 1: Generation of Gene‐Based Annotation Tables from Expanded Transcript Tables
Reagents and Solutions
Commentary
Literature Cited
Figures
Tables

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library Materials

Basic Protocol 1: DSAGE Library Construction Materials

Dynabeads mRNA DIRECT Kit (Invitrogen, cat. #610‐12), including oligo(dT) beads, lysis buffer, buffer A, and buffer B
High‐quality RNA, optionally from three to five sample replicates, extracted using RNAeasy kit (Qiagen, cat. #74104) or standard protocol using Trizol (Invitrogen, cat. #15596‐018)
SuperScript II reverse transcriptase (Invitrogen, cat. #18064‐022), including First Strand Buffer, DTT, and 10 mM dNTPs
Second‐Strand Buffer (Invitrogen, cat. #10812‐014)
E. coli DNA polymerase I (Invitrogen, cat. #18010025)
E. coli DNA ligase (Invitrogen, cat. #18052019)
E. coli RNase H (Invitrogen, cat. #18021071)
Buffers C, D, and E (see reciperecipes )
LoTE buffer (see recipe )
100× BSA (New England Biolabs, cat. #B9001S)
NEBuffer 4 (New England Biolabs, cat. #B7004S)
0.5 M EDTA, pH 8.0 ( appendix 22 )
Nla III (New England Biolabs, cat. #R0125L)
Adapters 1 and 2 (see recipe )
T4 DNA ligase, high concentration, with ligase buffer (Invitrogen, cat. #15224‐041)
Mme I (New England Biolabs, cat. #R0637L) with S ‐adenosylmethionine (SAM)
Phenol/chloroform (Ambion, cat. #AM9732), adjusted to pH 7.5‐8
GlycoBlue (Ambion, cat. #AM9515)
7.5 M ammonium acetate ( appendix 22 )
100% ethanol
10× BlueJuice gel loading buffer (Invitrogen, cat. #10816‐015)
Novex 20% TBE gels (Invitrogen, cat. #EC6315BOX)
Low‐molecular‐weight DNA ladder (New England Biolabs, cat. #N3233S)
SYBR Green I (Invitrogen, cat. #S7563)
Glycogen (Roche, cat. #10901393001)
MGB buffer (see recipe )
Dimethyl sulfoxide (DMSO)
10 mM dNTP mix
100 µM GexPCR primers A and B (Integrated DNA Technologies):
- 5′‐CAAGCAGAAGACGGCATACGA
- 5′‐AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
Platinum Taq DNA polymerase (Invitrogen, cat. #10966034)
Quant‐iT dsDNA HS Assay Kit (Invitrogen, cat. #Q32851)

0.5‐ and 1.5‐ml non‐stick RNase‐free microcentrifuge tubes (Ambion, cat. #12350 and 12450)
DynaMag‐2 magnet (Invitrogen, cat. #123‐21D)
16°C water bath
50° and 60°C heating blocks
UV light source
18‐G needle
Spin‐X centrifuge tube filters (Corning, cat. #8161)
Thermocycler
Qubit fluorometer (Invitrogen, cat. #Q32857)

Additional reagents and equipment for polyacrylamide (unit 2.7 ) and agarose (unit 2.5 ) gel electrophoresis

Basic Protocol 2: Generation and Comparison of Gene Expression Profiles Materials

Software pre‐requisites (if using versions other than indicated, test for compatibility):
- Bowtie 0.12.6
- Samtools 0.1.11
- Tophat 1.1.4
- BioPerl‐1.6.1
- Bio‐SamTools 1.24
- Perl v5.10.0
- BioPerl module for SAGE comparison
- Integrative Genomics Viewer
Analysis software package includes:
- Analysis programs written in Perl
- Reference files
Software package requires a Unix‐based computer; a computing cluster is strongly recommended (run time ∼1‐2 hr using a 2.4‐GHz computing node)

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library Figures

Figure 25.B0.1 cDNA library construction for DSAGE. mRNA is selected from total RNA using oligo(dT) ferromagnetic beads, and double‐stranded cDNA is synthesized while the mRNA is bound to the beads. cDNA is then cleaved with anchoring enzyme Nla III, leaving a 4‐bp 3′ overhang (CATG), which is ligated to a forward adapter containing an Mme I restriction site. Mme I cuts 20 bp downstream of the non‐palindromic recognition site, generating a 21‐bp unique tag sequence for each mRNA transcript. Finally, the reverse adapter containing a 2‐bp 3′ degenerate overhang is ligated.

View Image

Figure 25.B0.2 Library excision from a polyacrylamide gel. The 66‐bp pre‐PCR library (A ) and the final amplified 88‐bp library (B ) are shown.

View Image

Figure 25.B0.3 Data analysis pipeline. Sequenced tags in the FASTQ file are aligned to the genome and transcriptome. Gene expression profiles are generated by tallying the aligned tags for each gene. The resulting expression profiles can be compared to assess fold change and significance in gene expression.

View Image

Figure 25.B0.4 Tags aligned to the Nkx2‐5 locus from mouse left ventricle. Nkx2‐5 has three Nla III sites found in the first exon (denoted by an asterisk). The majority of the sequence tags were aligned to the most 3′ Nla III site, indicating that digestion with Nla III was nearly complete.

View Image

Videos

Literature Cited

Literature Cited
	Audic, S. and Claverie, J.M. 1997. The significance of digital gene expression profiles. Genome Res. 7:986‐995.
	Bentley, D.R., Balasubramanian, S., Swerdlow, H.P., Smith, G.P., Milton, J., Brown, C.G., et al. 2008. Accurate whole human genome sequencing using reversible terminator chemistry. Nature 456:53‐59.
	Draghici, S., Khatri, P., Eklund, A.C., and Szallasi, Z. 2006. Reliability and reproducibility issues in DNA microarray measurements. Trends Genet. 22:101‐109.
	Karolchik, D., Hinrichs, A.S., Furey, T.S., Roskin, K.M., Sugnet, C.W., Haussler, D., and Kent, W.J. 2004. The UCSC Table Browser data retrieval tool. Nucleic Acids Res. 32:D493‐D496.
	Kent, W.J., Sugnet, C.W., Furey, T.S., Roskin, K.M., Pringle, T.H., Zahler, A.M., and Haussler, D. 2002. The human genome browser at UCSC. Genome Res. 12:996‐1006.
	Kim, J.B., Porreca, G.J., Song, L., Greenway, S.C., Gorham, J.M., Church, G.M., Seidman, C.E., and Seidman, J.G. 2007. Polony multiplex analysis of gene expression (PMAGE) in mouse hypertrophic cardiomyopathy. Science 316:1481‐1484.
	Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. 2009. Ultrafast and memory‐efficient alignment of short DNA sequences to the human genome. Genome Biol. 10:R25.
	Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R.; 1000 Genome Project Data Processing Subgroup. 2009. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25:2078‐2079.
	Schroeder, A., Mueller, O., Stocker, S., Salowsky, R., Leiber, M., Gassmann, M., Lightfoot, S., Menzel, W., Granzow, M., and Ragg, T. 2006. The RIN: An RNA integrity number for assigning integrity values to RNA measurements. BMC Mol. Biol. 7:3.
	Trapnell, C., Pachter, L., and Salzberg, S.L. 2009. TopHat: Discovering splice junctions with RNA‐Seq. Bioinformatics 25:1105‐1111.
	Velculescu, V.E., Zhang, L., Vogelstein, B., and Kinzler, K.W. 1995. Serial analysis of gene expression. Science 270:484‐487.

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library

推荐方法