Phenotypic Analysis of BAT versus WAT Differentiation实验方法详情页

实验方法> 生物信息学技术> 数据库>Phenotypic Analysis of BAT versus WAT Differentiation

Phenotypic Analysis of BAT versus WAT Differentiation

关键词： phenotypic analysis bat versus来源：互联网

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

The Western world is in the midst of an epidemic of obesity, which is the cause of severe clinical complications such as type 2 diabetes, hypertension, and cardiovascular disease. Obesity develops when energy intake chronically exceeds energy expenditure; thus, either reducing the energy intake and/or increasing the energy expenditure has been used in the treatment and prevention of obesity. On a cellular level, energy storage is mediated by white adipocyte tissue (WAT). In contrast, brown adipose tissue (BAT) contributes to body temperature and metabolic homeostasis by metabolizing lipids and glucose. Adipose tissue is a notoriously difficult tissue to work with, due to the high content of triglycerides and the fragility of the cells. In this unit, several approaches to analysis of BAT and WAT are described that overcome these limitations. Curr. Protoc. Mouse Biol . 3:205?216 © 2013 by John Wiley & Sons, Inc.

Keywords: white adipose tissue; brown adipose tissue; adipogenesis; adipocytes; FACS; cryosectioning

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library Table of Contents

Introduction
Basic Protocol 1: Fluorescent‐Activated Cell Sorting (FACS) of Mature Adipocytes
Basic Protocol 2: qPCR Analysis of Brown Versus White Adipose Tissue
Basic Protocol 3: Cryosectioning and Staining of Brown and White Adipose Tissue
Reagents and Solutions
Commentary
Literature Cited
Figures
Tables

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library Materials

Basic Protocol 1: Fluorescent‐Activated Cell Sorting (FACS) of Mature Adipocytes Materials

Collagenase buffer (see recipe )
Collagenase type II (Clostridium histolyticum ; Sigma, cat. no. C6885‐1g)
Phosphate‐buffered saline (PBS)
Transgenic mouse with endogenous fluorescence in adipocytes (see for details)
Dulbecco's modified Eagle medium (DMEM) supplemented with 10% FBS and 1× penicillin/streptomycin (all ingredients from Life Technologies)
FACS buffer (see recipe ), cold
1 mg/ml 7‐aminoactinomycin D (7‐AAD; Sigma, cat. no. A9400‐1mg)
RNA lysis buffer (from MultiMACS cDNA Synthesis Kit; Miltenyi Biotec, cat. no. 130‐094‐410)

60‐mm cell culture plate
Dissection tools
Shaker
15‐ and 50‐ml conical polypropylene tubes (e.g., BD Falcon)
Centrifuge
100‐µm sieve (CellTrics from Partec)
FACS tubes
FACS instrument (e.g., Aria III High Speed Sorter; BD Bioscience)

Basic Protocol 2: qPCR Analysis of Brown Versus White Adipose Tissue Materials

Adipose tissue samples (WAT and/or BAT)
RNA purification kit or supplies (appropriate with respect to handling lipid‐laden samples; e.g., RNeasy Plus Micro Kit, Qiagen, cat. no. 74034; RNeasy Lipid Tissue Mini Kit, Qiagen, cat. no. 75842)
cDNA reverse transcription kit (High Capacity cDNA Reverse Transcription Kit; Applied Biosystems, cat. no. 4368813)
Primer pairs for designated housekeeping (see below) and target genes (Table 13.1.6700 )

Tissue homogenizer
Thermal cycler
Plates/wells and sealant for thermal cycler

Table 3.1.1 MaterialsPrimer Sequences for qRT‐PCR Reactions

Target gene	Forward primer	Reverse primer
36B4	GCCGTGATGCCCAGGGAAGA	CATCTGCTTGGAGCCCACGTT
Cidea	ACTTCCTCGGCTGTCTCAATGTCA	TCAGCAGATTCCTTAACACGGCCT
Cox7a1	CAGCGTCATGGTCAGTCTGT	AGAAAACCGTGTGGCAGAGA
Fabp4	ACAAGCTGGTGGTGGAATGTG	CCTTTGGCTCATGCCCTTT
Lep	CAGGATCAATGACATTTCACACA	GCTGGTGAGGACCTGTTGAT
Pparg	AGGCGAGGGCGATCTTGACAG	AATTCGGATGGCCACCTCTTTG
Retn	CTGTCCAGTCTATCCTTGCACAC	CAGAAGGCACAGCAGTCTTGA
TFIIB a	TGGAGATTTGTCCACCATGA	GAATTGCCAAACTCATCAAAACT
Ucp1	GGGCATTCAGAGGCAAATCAGCTT	ACACTGCCACACCTCCAGTCATTA

a Walden et al. ( ).

Basic Protocol 3: Cryosectioning and Staining of Brown and White Adipose Tissue Materials

Fixation solution (see recipe )
Transgenic mouse with endogenous fluorescence in adipocytes (see for details)
Phosphate‐buffered saline (PBS)
Cryopreservation solution (see recipe )
Dry ice
OCT medium (Tissue‐Tek from Sakura)
Permeabilization solution (see recipe )
0.05% (w/v) Triton X‐100 in PBS
Primary antibody solution (see recipe )
Secondary antibody solution (see recipe )
Vectashield HardSet (Vector Labs)
DAPI
Clear nail polish

Embedding cassettes
Aluminum foil
Plastic bags or boxes for storage
Cryotome with fresh cutting blades
SuperFrost Plus slides
Coverslips
Inverted laser‐scanning confocal microscope (Rajwa, )

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library Figures

Figure 1. Representative FACS plots from mature adipocyte fraction of interscapular adipose tissue after cold acclimatization. (A ) The dot plot represents a recording of the cells on the sample and the gating on the upper cell population of mature adipocytes. (B ) The histogram shows two different peaks, with the right one representing the GFP signal of part of the gated population. (C ) The GFP‐positive brown adipocyte population is re‐gated so that pure mature brown adipocytes are sorted. (D ) Dot plot of 7‐AAD staining and separation of alive (left) and dead (right) population.

View Image

Figure 2. Pparγ and Ucp1 expression levels in different adipose tissue cell fractions in vivo. Relative mRNA levels in separated adipocyte (adipo) and stromal‐vascular fractions (SVF) from different adipose tissues of C57BL/6 mice housed at 23°C are represented as bars.

View Image

Figure 3. Confocal images of immunohistochemical staining of murine BAT for UCP1 protein. Left panels show the DAPI nuclear counterstaining; right panels show the Alexa647 signal of the conjugated secondary antibody. Top: IgG isotype control as primary antibody; bottom: rabbit anti UCP1 primary antibody.

View Image

Figure 4. Confocal images of murine BAT from Ucp1‐GFP animals or transgene‐negative littermates. Left panels show the DAPI nuclear counterstaining; right panels show the endogenous GFP fluorescence or background fluorescence. Top: transgene‐negative tissue; bottom: transgene‐positive tissue.

View Image

Videos

Literature Cited

Literature Cited
	Cinti, S. 2005. The adipose organ. Prostaglandins Leukot. Essent. Fatty Acids 73:9‐15.
	Jaradat, S.A., Ko, M.S., and Grossman, L.I. 1998. Tissue‐specific expression and mapping of the Cox7ah gene in mouse. Genomics 49:363‐370.
	MacDougald, O.A., Hwang, C.S., Fan, H., and Lane, M.D. 1995. Regulated expression of the obese gene product (leptin) in white adipose tissue and 3T3‐L1 adipocytes. Proc. Natl. Acad. Sci. U.S.A. 92:9034‐9037.
	Nedergaard, J., Bengtsson, T., and Cannon, B. 2011. New powers of brown fat: Fighting the metabolic syndrome. Cell Metab. 13:238‐240.
	Petrovic, N., Walden, T.B., Shabalina, I.G., Timmons, J.A., Cannon, B., and Nedergaard, J. 2010. Chronic peroxisome proliferator‐activated receptor gamma (PPARgamma) activation of epididymally derived white adipocyte cultures reveals a population of thermogenically competent, UCP1‐containing adipocytes molecularly distinct from classic brown adipocytes. J. Biol. Chem. 285:7153‐7164.
	Rajwa, B. 2005. Modern confocal microscopy. Curr. Protoc. Cytom. 31:12.3.1‐12.3.12.
	Rosenwald, M., Perdikari, A., Rulicke, T., and Wolfrum, C. 2013. Bi‐directional interconversion of brite and white adipocytes. Nat. Cell. Biol. 15:659‐667.
	Steppan, C.M., Bailey, S.T., Bhat, S., Brown, E.J., Banerjee, R.R., Wright, C.M., Patel, H.R., Ahima, R.S., and Lazar, M.A. 2001. The hormone resistin links obesity to diabetes. Nature 409:307‐312.
	Tseng, Y.H., Cypess, A.M., and Kahn, C.R. 2010. Cellular bioenergetics as a target for obesity therapy. Nat. Rev. Drug Discov. 9:465‐482.
	Walden, T.B., Hansen, I.R., Timmons, J.A., Cannon, B., and Nedergaard, J., 2012. Recruited vs. nonrecruited molecular signatures of brown, “brite,” and white adipose tissues. Am. J. Physiol. Endocrinol. Metab. 302:E19‐E31.
	Wu, J., Bostrom, P., Sparks, L.M., Ye, L., Choi, J.H., Giang, A.H., Khandekar, M., Virtanen, K.A., Nuutila, P., Schaart, G., Huang, K., Tu, H., van Marken Lichtenbelt, W.D., Hoeks, J., Enerback, S., Schrauwen, P., and Spiegelman, B.M. 2012. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell 150:366‐376.
	Young, P., Arch, J.R., and Ashwell, M. 1984. Brown adipose tissue in the parametrial fat pad of the mouse. FEBS Lett. 167:10‐14.
	Zhou, Z., Yon Toh, S., Chen, Z., Guo, K., Ng, C.P., Ponniah, S., Lin, S.C., Hong, W., and Li, P. 2003. Cidea‐deficient mice have lean phenotype and are resistant to obesity. Nat. Genet. 35:49‐56.

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library

推荐方法