Overview of Formation of G‐Quadruplex Structures实验方法详情页

实验方法> 生物信息学技术> 数据库>Overview of Formation of G‐Quadruplex Structures

Overview of Formation of G‐Quadruplex Structures

关键词： overview of formation来源：互联网

Abstract
Table of Contents
Figures
Literature Cited

Abstract

There are many structures that can be adopted by nucleic acids other than the Watson?Crick duplex. In particular, a noncanonical four?stranded topology, called a G?quadruplex, is of great interest because of its roles in key biological processes such as the maintenance of telomeres and regulation of gene transcription. This review describes the condition for forming the G?quadruplex structure, G?quadruplex?forming sequences, and methods for studying the structures. Curr. Protoc. Nucleic Acid Chem. 40:17.2.1?17.2.17. © 2010 by John Wiley & Sons, Inc.

Keywords: DNA structure; quadruplex?forming sequences; methods; conditions

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library Table of Contents

Introduction
Conditions for Forming the G‐Quadruplex Structure
Methods for Studying G‐Quadruplex Structures
G‐Quadruplex‐Forming Sequences
Conclusion and Future Directions
Acknowledgements
Literature Cited
Figures

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library Materials

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library Figures

Figure 17.2.1 (A ) Formation of a G‐tetrad. (B ) Anti (left) and syn (right) guanine conformations. (C ) Orientations of G‐strands. (i) All strands in the same direction. (ii) Three strands in one direction, and the fourth in the opposite direction. (iii) Two neighboring strands oriented in one direction, and the other two in the opposite direction. (iv) Each strand antiparallel to adjacent neighbors. Blue and red boxes represent guanine bases in the anti and syn conformations, respectively. (D ) Three kinds of loops connect the G‐tetrad.

View Image

Figure 17.2.2 Various types of modifications studied in on quadruplex formation. Chemical formulas of (A ) 6‐Methylguanine, (B ) Inosine, (C ) 6‐Thioguanine, (D ) 8‐Aminoguanine, (E ) 8‐Methylguanine, (F ) 8‐Bromoguanine, and (G ) 7,8‐dihydro‐8‐oxoguanine. Schematic representations of the G‐quadruplex structures containing a (H ) 3′‐3′ or (I ) 5′‐5′ inversion of polarity in d(TGGGGT) and (J ) bunch‐[d(TG4 T)]4 . Conformations of (K ) DNA, (L ) RNA, and (M ) LNA.

View Image

Figure 17.2.3 Folding topology of the human telomeric G‐quadruplex formed by (A ) d[AG3 (T2 AG3 )3 ] in Na+ solution, (B ) d[AG3 (T2 AG3 )3 ] in K+ crystal structure, (C ) d[TAG3 (T2 AG3 )3 ] in K+ solution, (D ) d[TA G3 (T2 AG3 )3 TT] in K+ solution and (E ) d[G3 (T2 AG3 )3 T] in K+ solution. Folding topology of the unimolecular G‐quadruplex structures of (F ) d(TGAGGGTGGGTAGGGTGGGTAA) in the c‐Myc promoter sequence, (G ) d(AGGGAGGGCGCTGGGAGGAGGG) in the c‐kit promoter sequence and (H ) d(GGGCGCGGGAGGAATTGGGCGGG) in the Bcl‐2 promoter sequence.

View Image

Videos

Literature Cited

Literature Cited
	Ambrus, A., Chen, D., Dai, J., Bialis, T., Jones, R.A., and Yang, D. 2006. Human telomeric sequence forms a hybrid‐type intramolecular G‐quadruplex structure with mixed parallel/antiparallel strands in potassium solution. Nucleic Acids Res. 34: 2723‐2735.
	Armond, D.R., Wood, S., Sun, D., Hurley, L.H. and Ebbinghaus, S.W. 2005. Evidence for the presence of a guanine quadruplex forming region within a polypurine tract of the hypoxia inducible factor 1alpha promoter. Biochemistry 44: 16341‐16350.
	Arnal‐Hérault, C., Banu, A., Barboiu, M., Michau, M., and van der Lee, A. 2007. Amplification and transcription of the dynamic supramolecular chirality of the guanine quadruplex. Angew. Chem. Int. Ed. 46: 4268‐4272.
	Azzalin, C.M., Reichenbach, P., Khoriauli, L., Giulotto, E., and Lingner, J. 2007. Telomeric repeat‐containing RNA and RNA surveillance factors at mammalian chromosome ends. Science 318: 798‐801.
	Bang, I. 1910. Untersuchungen über die Guanylsäure. Biochem. Z. 26: 293‐311.
	Bates, P.J., Mergny, J.L., and Yang, D. 2007. Quartets in G‐major – The first international meeting on quadruplex DNA. EMBO Rep. 8: 1003‐1010.
	Bates, P.J., Laber, D.A., Miller, D.M., Thomas, S.D., and Trent, J.O. 2009. Discovery and development of the G‐rich oligonucleotide AS1411 as a novel treatment for cancer. Exp. Mol. Pathol. 86: 151‐164.
	Blume, S.W., Guarcello, V., Zacharias, W., and Miller, D.M. 1997. Divalent transition metal cations counteract potassium‐induced quadruplex assembly of oligo(dG) sequences. Nucleic Acids Res. 25: 617‐625.
	Bonifacio, L., Church, F.C., and Jarstfer, M.B. 2008. Effect of locked‐nucleic acid on a biologically active G‐quadruplex. A structure‐activity relationship of the thrombin aptamer. Int. J. Mol. Sci. 9: 422‐433.
	Bryan, T.M., Englezou, A., Gupta, J., Bacchetti, S., and Reddel, R.R. 1995. Telomere elongation in immortal human cells without detectable telomerase activity. EMBO J. 14: 4240‐4248.
	Campbell, N.H. and Parkinson, G.N. 2007. Crystallographic studies of quadruplex nucleic acids. Methods 43: 252‐263.
	Chang, C.C., Wu, J.Y., Chien, C.W., Wei‐Sung Wu, W.S., Liu, H., Kang, C.C., Yu, L.J., and Chang, T.C. 2003. A fluorescent carbazole derivative: High sensitivity for quadruplex DNA. Anal. Chem. 75: 6177‐6183.
	Chang, C.C., Chu, J.F., Kao, F.J., Chiu, Y.C., Lou, P.J., Chen, H.C., and Chang, T.C. 2006. Verification of antiparallel G‐quadruplex structure in human telomeres by using two‐photon excitation fluorescence lifetime imaging microscopy of the 3,6‐bis(1‐methyl‐4‐vinylpyridinium)carbazole diiodide molecule. Anal. Chem. 78: 2810‐2815.
	Chao, D.T. and Korsmeyer, S.J. 1998. BCL‐2 FAMILY: Regulators of cell death. Annu. Rev. Immunol. 16: 395‐419.
	Chen, F.M. 1992. Sr2+ Facilitates intermolecular G‐quadruplex formation of telomeric sequences. Biochemistry 31: 3769‐3776.
	Cogoi, S. and Xodo, L.E. 2006. G‐quadruplex formation within the promoter of the KRAS proto‐oncogene and its effect on transcription. Nucleic Acids Res. 34: 2536‐2549.
	Creze, C., Rinaldi, B., Haser, R., Bouvet, P., and Gouet, P. 2007. Structure of a d(TGGGGT) quadruplex crystallized in the presence of Li+ ions. Acta Cryst. D63: 682‐688.
	Dai, J., Dexheimer, T.S., Chen, D., Carver, M., Ambrus, A., Jones, R.A., and Yang, D. 2006. An intramolecular G‐quadruplex structure with mixed parallel/antiparallel G‐strands formed in the human BCL‐2 promoter region in solution. J. Am. Chem. Soc. 128: 1096‐1098.
	Dai, J., Carver, M., Punchihewa, C., Jones, R.A., and Yang, D. 2007. Structure of the Hybrid‐2 type intramolecular human telomeric G‐quadruplex in K+ solution: Insights into structure polymorphism of the human telomeric sequence. Nucleic Acids Res. 35: 4927‐4940.
	Dapić, V., Abdomerović, V., Marrington, R., Peberdy, J., Rodger, A., Trent, J.O., and Bates, P.J. 2003. Biophysical and biological properties of quadruplex oligodeoxyribonucleotides. Nucleic Acids Res. 31: 2097‐2107.
	Esposito, V., Randazzo, A., Piccialli, G., Petraccone, L., Giancola, C., and Mayol, L. 2004. Effects of an 8‐bromodeoxyguanosine incorporation on the parallel quadruplex structure [d(TGGGT)]4. Org. Biomol. Chem. 2: 313‐318.
	Esposito, V., Virgilio, A., Randazzo, A., Galeone, A., and Mayol, L. 2005. A new class of DNA quadruplexes formed by oligodeoxyribonucleotides containing a 3′‐3′ or 5′‐5′ inversion of polarity site. Chem. Commun. 31: 3953‐3955.
	Gabelica, V., Rosu, F., Pauw, E.D., Lemaire, J., Gillet, J.C., Poully, J.C., Lecomte, F., Grégoire, G., Schermann, J.P., and Desfraçnois, C. 2008. Infrared signature of DNA G‐quadruplexes in the gas phase. J. Am. Chem. Soc. 130: 1810‐1811.
	Gaynutdinov, T.I., Neumann, R., and Panyutin, I.G. 2008. Structural polymorphism of intramolecular quadruplex of human telomeric DNA: Effect of cations, quadruplex‐binding drugs and flanking sequences. Nucleic Acids Res. 36: 4079‐4087.
	Gellert, M., Lipsett, M.N., and Davies, D.R. 1962. Helix formation by guanylic acid. Proc. Natl. Acad. Sci. U.S.A. 48: 2013‐2018.
	Gill, M.L., Strobel, S.A., and Loria, J.P. 2005. 205Tl NMR methods for the characterization of monovalent cation binding to nucleic acids. J. Am. Chem. Soc. 127: 16723‐16732.
	Gray, D.M., Wen, J.D., Gray, C.W., Repges, R., Repges, C., Raabe, G., and Fleischhauer, J. 2008. Measured and calculated CD Spectra of G‐quartets stacked with the same or opposite polarities. Chirality 20: 431‐440.
	Gros, J., Rosu, F., Amrane, S., Cian, A.D., Gabelica, V., Lacroix, L., and Mergny, J.L. 2007. Guanines are a quartet's best friend: Impact of base substitutions on the kinetics and stability of tetramolecular quadruplexes. Nucleic Acids Res. 35: 3064‐3075.
	Gros, J., Aviñó, A., Lopez de la Osa, J., González, C., Lacroix, L., Pérez, A., Orozco, M., Eritja, R., and Mergny, J.L. 2008. 8‐Amino guanine accelerates tetramolecular G‐quadruplex formation. Chem. Commun. 25: 2926‐2928.
	Guo, K., Pourpak, A., Beetz‐Rogers, K., Gokhale, V., Sun, D., and Hurley, L.H. 2007. Formation of pseudosymmetrical G‐quadruplex and i‐motif structures in the proximal promoter region of the RET oncogene. J. Am. Chem. Soc. 129: 10220‐10228.
	Haider, S., Parkinson, G.N., and Neidle, S. 2008. Molecular dynamics and principal components analysis of human telomeric quadruplex multimers. Biophys. J. 95: 296‐311.
	Harley, C.B., Futcher, A.B., and Greider, C.W. 1990. Telomeres shorten during ageing of human fibroblasts. Nature 345: 458‐460.
	Haq, I., Chowdhry, B.Z., and Jenkins, T.C. 2001. Calorimetric techniques in the study of high‐order DNA‐drug interactions. Methods Enzymol. 340: 109‐149.
	Hellman, L.M., Rodgers, D.W., and Fried, M.G. 2009. Phenomenological partial‐specific volumes for G‐quadruplex DNAs. Eur Biophys J. 39:389‐396.
	Hong, Y., Haubler, M., Lam, J.W.Y., Li, Z., Sin, K.K., Dong, Y., Tong, H., Liu, J., Qin, A., Renneberg, R., and Tang, B.Z. 2008. Label‐free fluorescent probing of G‐quadruplex formation and real‐time monitoring of DNA folding by a quaternized tetraphenylethene salt with aggregation‐Induced emission characteristics. Chem. Eur. J. 14: 6428‐6437.
	Huang, C.Z., Liao, Q.G., Gan, L.H., Guo, F.L., and Li, Y.F. 2007. Telomere DNA conformation change induced aggregation of gold nanoparticles as detected by plasmon resonance light scattering technique. Analytica Chimica Acta. 604: 165‐169.
	Hud, N.V., Smith, F.W., Anet, F.A.L., and Feigon, J. 1996. The selectivity for K+ versus Na+ in DNA quadruplexes is dominated by relative free energies of hydration: A thermodynamic analysis by 1H NMR. Biochemistry 35: 15383‐15390.
	Huppert, J.L. and Balasubramanian, S. 2005. Prevalence of quadruplexes in the human genome. Nucleic Acids Res. 33: 2908‐2916.
	Jeniffer, A.K., Juli, F., and Todd, O.Y. 1996. Reconciliation of the X‐ray and NMR structures of the thrombin‐binding aptamer d(GGTTGGTGTGGTTGG) J. Mol. Biol. 256: 417‐422.
	Kan, Z.Y., Lin, Y., Wang, F., Zhuang, X.Y., Zhao, Y., Pang, D.W., Hao, Y.H., and Tan, Z. 2007. G‐quadruplex formation in human telomeric (TTAGGG)4 sequence with complementary strand in close vicinity under molecularly crowded condition. Nucleic Acids Res. 35: 3646‐3653.
	Kim, N.W., Piatyszek, M.A., Prowse, K.R., Harley, C.B., West, M.D., Ho, P.L., Coviello, G.M., Wright, W.E., Weinrich, S.L., and Shay, J.W. 1994. Specific association of human telomerase activity with immortal cells and cancer. Science 266: 2011‐2015.
	Kimura, T., Kawai, K., Fujitsuka, M., and Majima, T. 2004. Fluorescence properties of 2‐aminopurine in human telomeric DNA. Chem. Commun. 12: 1438‐1439.
	Kouvaraki, M.A., Shapiro, S.E., Perrier, N.D., Cote, G.J., Gagel, R.F., Hoff, A.O., Sherman, S.I., Lee, J.E., and Evans, D.B. 2005. RET proto‐oncogene: A review and update of genotype‐phenotype correlations in hereditary medullary thyroid cancer and associated endocrine tumors. Thyroid 15: 531‐544.
	Kranenberg, O. 2005. The KRAS oncogene. Past, present, and future. Biochim. Biophys. Acta. 176: 81‐82.
	Kumar, N. and Maiti, S. 2007. Role of locked nucleic acid modified complementary strand in quadruplex/Watson‐Crick duplex equilibrium. J. Phys. Chem. B 111: 12328‐12337.
	Kumar, N., Basundra, R., and Maiti, S. 2009. Elevated polyamines induce c‐MYC overexpression by perturbing quadruplex‐WC duplex equilibrium. Nucleic Acids Res. 37: 3321‐3331.
	Kwan, I.C.M., Mo, X., and Wu, G. 2007. Probing hydrogen bonding and ion‐carbonyl interactions by solid‐state 17O NMR spectroscopy: G‐ribbon and G‐quartet. J. Am. Chem. Soc. 129: 2398‐2407.
	Lee, J.Y. and Kim, D.S. 2009. Dramatic effect of single‐base mutation on the conformational dynamics of human telomeric G‐quadruplex. Nucleic Acids Res. 37: 3625‐3634.
	Lee, J.Y., Yoon, J., Kim, H.W., and Kim, D.S. 2008. Structural diversity and extreme stability of unimolecular oxytricha nova telomeric G‐quadruplex. Biochemistry. 47: 3389‐3396.
	Li, J., Correia, J.J., Wang, L., Trent, J.O., and Chaires, J.B. 2005. Not so crystal clear: The structure of the human telomere G‐quadruplex in solution differs from that present in a crystal. Nucleic Acids Res. 33: 4649‐4659.
	Lim, K.W., Amrane, S., Bouaziz, S., Xu, W., Mu, Y., Patel, D.J., Luu, K.N., and Phan, A.T. 2009. Structure of the human telomere in K+ solution: a stable basket‐type G‐quadruplex with only two G‐tetrad layers. J. Am. Chem. Soc. 131: 4301‐4309.
	Louis, C.B., Linda, C.G., John, A.L., Eric, H.V., and John, J.T. 1992. Selection of single‐stranded DNA molecules that bind and inhibit human thrombin. Nature 355: 564‐566.
	Luu, K.N., Phan, A.T., Kuryavyi, V., Lacroix, L., and Patel, D.J. 2006. Structure of the human telomere in K+ solution: An intramolecular (3 + 1) G‐quadruplex scaffold. J. Am. Chem. Soc. 128: 9963‐9970.
	Lynch, S., Baker, H., Byker, S.G., Zhou, D., and Sinniah, K. 2009. Single molecule force spectroscopy on G‐quadruplex DNA. Chem. Eur. J. 15: 8113‐8116.
	Marathias, V.M., Sawicki, M.J., and Bolton, P.H. 1999. 6‐Thioguanine alters the structure and stability of duplex DNA and inhibits quadruplex DNA formation. Nucleic Acids Res. 27: 2860‐2867.
	Marcu, K.B., Bossone, S.A., and Patel, A.J. 1992. Myc function and regulation. Annu. Rev. Biochem. 61: 809‐860.
	Marsh, T.C., Vesenka, J., Henderson, E. 1995. A new DNA nanostructure, the G‐wire, imaged by scanning probe microscopy. Nucleic Acids Res. 23: 696‐700.
	Martadinata, H. and Phan, A.T. 2009. Structure of propeller‐type parallel‐stranded RNA G‐quadruplexes, formed by human telomeric RNA sequences in K+ solution. J. Am. Chem. Soc. 131: 2570‐2578.
	Martiny‐Baron, G. and Marme, D. 1995. VEGF‐mediated tumour angiogenesis: A new target for cancer therapy. Curr. Opin. Biotechnol. 6: 675‐680.
	Masse, J.E., Bortmann, P., Dieckmann, T., and Feigon, J. 1998. Simple, efficient protocol for enzymatic synthesis of uniformly 13C, 15N‐labeled DNA for heteronuclear NMR studies. Nucleic Acids Res. 26: 2618‐2624.
	Mathur, V., Verma, A., Maiti, S., and Chowdhury, S. 2004. Thermodynamics of itetraplex formation in the nuclease hypersensitive element of human c‐myc promoter. Biochem. Biophys. Res. Commun. 320: 1220‐1227.
	Matsugami, A., Xu, Y., Noguchi, Y., Sugiyama, H., and Katahira, M. 2007. Structure of a human telomeric DNA sequence stabilized by 8‐bromoguanosine substitutions, as determined by NMR in a K+ solution. FEBS J. 274: 3545‐3556.
	Mekmaysy, C.S., Petraccone, L., Garbett, N.C., Ragazzon, P.A., Gray, R., Trent, J.O., and Chaires, J.B. 2008. Effect of O6‐methylguanine on the stability of G‐quadruplex DNA. J. Am. Chem. Soc. 130: 67100‐67111.
	Miura, T. and Thomas, G.J. Jr. 1994. Structural polymorphism of telomere DNA: Interquadruplex and duplex‐quadruplex conversions probed by raman spectroscopy. Biochemistry 33: 7848‐7856.
	Miura, T. and Thomas, G.J. Jr. 1995. Structure and dynamics of interstrand guanine association in quadruplex telomeric DNA. Biochemistry 34: 9645‐9654.
	Miyoshi, D., Nakao, A., Toda, T., and Sugimoto, N. 2001. Effect of divalent cations on antiparallel G‐quartet structure of d(G4T4G4). FEBS Lett. 496: 128‐133.
	Miyoshi, D., Nakao, A., and Sugimoto, N. 2002. Molecular crowding regulates the structural switch of the DNA G‐quadruplex. Biochemistry 41: 15017‐15024.
	Nagatoishi, S., Nojima, T., Juskowiak, B., and Takenaka, S. 2005. A pyrene‐labeled G‐quadruplex oligonucleotide as a fluorescent probe for potassium ion detection in biological applications. Angew. Chem. Int. Ed. 44: 5067‐5070.

推荐方法