Real‐Time Quantitative PCR Analysis of Mitochondrial DNA Content实验方法详情页

实验方法> 生物信息学技术> 数据库>Real‐Time Quantitative PCR Analysis of Mitochondrial DNA Content

Real‐Time Quantitative PCR Analysis of Mitochondrial DNA Content

关键词： real time quantitative来源：互联网

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

Mitochondrial disorders are a group of complex and heterogeneous diseases that may be caused by molecular defects in the nuclear or mitochondrial genome. The biosynthesis and integrity of the small 16.6?kb mitochondrial genome require a group of nuclear encoded genes. The mitochondrial DNA (mtDNA) depletion syndromes (MDDSs) are autosomal recessive disorders caused by molecular defects in nuclear genes, and characterized by a reduction in mtDNA content. To date, mutations in at least nine genes (POLG , DGUOK , TK2 , TYMP , MPV17 , SUCLA2 , SUCLG1 , RRM2B , and C10orf2 ) have been reported to cause various forms of MDDSs. In the clinical setting, a simple method to determine mtDNA depletion would be useful prior to undertaking gene sequence analysis. This unit outlines the real?time quantitative polymerase chain reaction (qPCR) analysis of mtDNA content in tissues. MtDNA content varies among different tissues and at different ages in the same individual. Detailed protocols for the selection of nuclear genes for normalization, PCR set up, validation procedures, tissue and age matched controls, and sensitivity and specificity in various tissues, as well as interpretation of results are discussed. Curr. Protoc. Hum. Genet. 68:19.7.1?19.7.12 © 2011 by John Wiley & Sons, Inc.

Keywords: mtDNA copy number; mtDNA content; mtDNA qPCR; quantification of mtDNA content; mtDNA depletion

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library Table of Contents

Introduction
Strategic Planning
Basic Protocol 1: Real‐Time Quantitative PCR for the Quantification of mtDNA Content
Support Protocol 1: Generation of mtDNA Age‐Matched Controls
Support Protocol 2: Preparation and Quantification of DNA Samples
Commentary
Literature Cited
Figures
Tables

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library Materials

Basic Protocol 1: Real‐Time Quantitative PCR for the Quantification of mtDNA Content Materials

Genomic DNA samples (see protocol 4 )
qPCR primers for mitochondrial tRNALeu(UUR) gene, alternate primers for mtDNA 16S rRNA gene and nuclear β‐2‐microglobulin (β2M ) gene (Table 19.7.2 ), 5 µM working concentration diluted in water
iTaq SYBR Green SuperMix with ROX (Bio‐Rad, cat. no. 170‐8852)
Tissue‐ and age‐matched pooled controls (see protocol 3 )

PCR hood
96‐well thin‐walled PCR plates
Adhesive plate sealer
ABI Prism 7900HT sequence detector system (Applied Biosystems)

Data analysis software: SDS software (version 2.2) Table 9.7.2 MaterialsqPCR Primer Sequences and Conditions

Gene	Primer name	Primer sequence (5′ to 3′)	Amplicon size (bp)	Annealing temperature (°C)
mtDNA tRNALeu(UUR)	tRNA F3212	CACCCAAGAACAGGGTTTGT	107	62
	tRNA R3319	TGGCCATGGGTATGTTGTTA
nDNA β2‐microglobulin	β2M F594	TGCTGTCTCCATGTTTGATGTATCT	86	62
	β2M R679	TCTCTGCTCCCCACCTCTAAGT
Alternate primers:mtDNA 16S rRNA	mtF3163	GCCTTCCCCCGTAAATGATA	97	62
	mtR3260	TTATGCGATTACCGGGCTCT

Support Protocol 1: Generation of mtDNA Age‐Matched Controls Materials

Tissues
Puregene kit (Gentra Systems, cat. no. D50K1) including:
- Red cell lysis solution
- Cell lysis solution
- DNA hydration solution
- Protein precipitation solution
100% isopropanol
70% ethanol
Rapid hair digestion buffer: 10 mM Tris⋅Cl (pH 8.0), 1.0% Brij 58, 35 mM DTT, 1 mM CaCl 2
Calf thymus DNA standards (type XV; Sigma, cat. no. D4522)
NanoDrop ND‐1000 UV‐Vis spectrophotometer

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library Figures

Figure 19.7.1 Cycle parameters utilized for amplification by qPCR. Annealing temperatures can vary according to different T m .

View Image

Figure 19.7.2 mtDNA copy number amplification plot. The amplification plot represents two patient samples with an age‐matched muscle control. Curves 1 through 3 represent mtDNA amplification of samples with increased mtDNA copy number, normal copy number in an age matched control, and mtDNA depletion, respectively. Curves 4 through 6 represent the amplification of the nDNA using β2M primer set for the same three samples. The results are calculated in Table .

View Image

Figure 19.7.3 Control mtDNA content across blood and muscle samples by age. Reprinted with permission from Clinical Chemistry (Dimmock et al., ).

View Image

Videos

Literature Cited

Literature Cited
	Antonicka, H., Mattman, A., Mattman, A., Carlson, C.G., Glerum, D.M., Hoffbuhr, K.C., Leary, S.C., Kennaway, N.G., and Shoubridge, E.A. 2003. Mutations in COX15 produce a defect in the mitochondrial heme biosynthetic pathway, causing early‐onset fatal hypertrophic cardiomyopathy. Am. J. Hum. Genet. 72:101‐114.
	Bai, R.K. and Wong, L.J. 2004. Detection and quantification of heteroplasmic mutant mitochondrial DNA by real‐time amplification refractory mutation system quantitative PCR analysis: A single‐step approach. Clin. Chem. 50:996‐1001.
	Bai, R.K. and Wong, L.J. 2005. Simultaneous detection and quantification of mitochondrial DNA deletion(s), depletion, and over‐replication in patients with mitochondrial disease. J. Mol. Diagn. 7:613‐622.
	Bourdon, A., Minai, L., Serre, V., Jais, J.P., Sarzi, E., Aubert, S., Chrétien, D., de Lonlay, P., Paquis‐Flucklinger, V., Arakawa, H., Nakamura, Y., Munnich, A., and Rötig, A. 2007. Mutation of RRM2B, encoding p53‐controlled ribonucleotide reductase (p53R2), causes severe mitochondrial DNA depletion. Nat. Genet. 39:776‐780.
	Carrozzo, R., Dionisi‐Vici, C., Steuerwald, U., Lucioli, S., Deodato, F., Di Giandomenico, S., Bertini, E., Franke, B., Kluijtmans, L.A., Meschini, M.C., Rizzo, C., Piemonte, F., Rodenburg, R., Santer, R., Santorelli, F.M., van Rooij, A., Vermunt‐de Koning, D., Morava, E., and Wevers, R.A. 2007. SUCLA2 mutations are associated with mild methylmalonic aciduria, Leigh‐like encephalomyopathy, dystonia and deafness. Brain 130:862‐874.
	Dimmock, D.P., Zhang, Q., Dionisi‐Vici, C., Carrozzo, R., Shieh, J., Tang, L.Y., Truong, C., Schmitt, E., Sifry‐Platt, M., Lucioli, S., Santorelli, F.M., Ficicioglu, C.H., Rodriguez, M., Wierenga, K., Enns, G.M., Longo, N., Lipson, M.H., Vallance, H., Craigen, W.J., Scaglia, F., and Wong, L.J. 2008. Clinical and molecular features of mitochondrial DNA depletion due to mutations in deoxyguanosine kinase. Hum. Mutat. 29:330‐331.
	Dimmock, D., Tang, L.Y., Schmitt, E.S., and Wong, L.J. 2010. A quantitative evaluation of the mitochondrial DNA depletion syndrome. Clin. Chem. 56:1119‐1127.
	Elpeleg, O., Miller, C., Hershkovitz, E., Bitner‐Glindzicz, M., Bondi‐Rubinstein, G., Rahman, S., Pagnamenta, A., Eshhar, S., and Saada, A. 2005. Deficiency of the ADP‐forming succinyl‐CoA synthase activity is associated with encephalomyopathy and mitochondrial DNA depletion. Am. J. Hum. Genet. 76:1081‐1086.
	Galbiati, S., Bordoni, A., Papadimitriou, D., Toscano, A., Rodolico, C., Katsarou, E., Sciacco, M., Garufi, A., Prelle, A., Aguennouz, M., Bonsignore, M., Crimi, M., Martinuzzi, A., Bresolin, N., Papadimitriou, A., and Comi, G.P. 2006. New mutations in TK2 gene associated with mitochondrial DNA depletion. Pediatr. Neurol. 34:177‐185.
	Hakonen, A.H., Isohanni, P., Paetau, A., Herva, R., Suomalainen, A., and Lönnqvist, T. 2007. Recessive TWINKLE mutations in early onset encephalopathy with mtDNA depletion. Brain 130:3032‐3040.
	Lee, N.C., Dimmock, D., Hwu, W.L., Tang, L.Y., Huang, W.C., Chinault, A.C., and Wong, L.J. 2009. Simultaneous detection of mitochondrial DNA depletion and single‐exon deletion in the deoxyguanosine gene using array‐based comparative genomic hybridisation. Arch. Dis. Child 94:55‐58.
	Nishino, I., Spinazzola, A., and Hirano, M. 1999. Thymidine phosphorylase gene mutations in MNGIE, a human mitochondrial disorder. Science 283:689‐692.
	Ostergaard, E., Hansen, F.J., Sorensen, N., Duno, M., Vissing, J., Larsen, P.L., Faeroe, O., Thorgrimsson, S., Wibrand, F., Christensen, E., and Schwartz, M. 2007a. Mitochondrial encephalomyopathy with elevated methylmalonic acid is caused by SUCLA2 mutations. Brain 130:853‐861.
	Ostergaard, E., Christensen, E., Kristensen, E., Mogensen, B., Duno, M., Shoubridge, E.A., and Wibrand, F. 2007b. Deficiency of the alpha subunit of succinate‐coenzyme A ligase causes fatal infantile lactic acidosis with mitochondrial DNA depletion. Am. J. Hum. Genet. 81:383‐387.
	Pontarin, G., Fijolek, A., Pizzo, P., Ferraro, P., Rampazzo, C., Pozzan, T., Thelander, L., Reichard, P.A., and Bianchi, V. 2008. Ribonucleotide reduction is a cytosolic process in mammalian cells independently of DNA damage. Proc. Natl. Acad. Sci. U.S.A. 105:17801‐17806.
	Sarzi, E., Goffart, S., Serre, V., Chrétien, D., Slama, A., Munnich, A., Spelbrink, J.N., and Rötig, A. 2007. TWINKLE helicase (PEO1) gene mutation causes mitochondrial DNA depletion. Ann. Neurol. 62:579‐587.
	Shaibani, A., Shchelochkov, O.A., Zhang, S., Katsonis, P., Lichtarge, O., Wong, L.J., and Shinawi, M. 2009. Mitochondrial neurogastrointestinal encephalopathy due to mutations in RRM2B. Arch. Neurol. 66:1028‐1032.
	Shanske, S. and Wong, L.J. 2004. Molecular analysis for mitochondrial DNA disorders. Mitochondrion 4:403‐415.
	Spinazzola, A. and Zeviani, M. 2007. Disorders of nuclear‐mitochondrial intergenomic communication. Biosci. Rep. 27:39‐51.
	Spinazzola, A. and Zeviani, M. 2009. Disorders from perturbations of nuclear‐mitochondrial intergenomic cross‐talk. J. Intern. Med. 265:174‐192.
	Tay, S.K., Shanske, S., Kaplan, P., and DiMauro, S. 2004. Association of mutations in SCO2, a cytochrome c oxidase assembly gene, with early fetal lethality. Arch. Neurol. 61:950‐952.
	Wong, L.J., Brunetti‐Pierri, N., Zhang, Q., Yazigi, N., Bove, K.E., Dahms, B.B., Puchowicz, M.A., Gonzalez‐Gomez, I., Schmitt, E.S., Truong, C.K., Hoppel, C.L., Chou, P.C., Wang, J., Baldwin, E.E., Adams, D., Leslie, N., Boles, R.G., Kerr, D.S., and Craigen, W.J. 2007. Mutations in the MPV17 gene are responsible for rapidly progressive liver failure in infancy. Hepatology 46:1218‐1227.
	Wong, L.J., Naviaux, R.K., Brunetti‐Pierri, N., Zhang, Q., Schmitt, E.S., Truong, C., Milone, M., Cohen, B.H., Wical, B., Ganesh, J., Basinger, A.A., Burton, B.K., Swoboda, K., Gilbert, D.L., Vanderver, A., Saneto, R.P., Maranda, B., Arnold, G., Abdenur, J.E., Waters, P.J., and Copeland, W.C. 2008. Molecular and clinical genetics of mitochondrial diseases due to POLG mutations. Hum. Mutat. 29:E150‐E172.

GO TO THE FULL PROTOCOL: PDF or HTML at Wiley Online Library

推荐方法